Mutation lacZ4823
- Name: lacZ4823
- Type: Insertion
- Mutation of Gene: lacZ
- Approx. Map Location: 7.18
- Synonyms
Designation Where Used lacZ(+11) Seier et al., 2011 - Comments
- is a compound allele replacing ATACACT-----------TGCTGATGCGG with ATACACTTGCTGATGCGGTGCTGATGCGG starting at base 2486 in the lacZ sequence. This results in an 11 basepair duplication and a frameshift mutation.
- References
- 2 Strains Carrying This Mutation
Name Mutations Genotype STL14025 4 F-, lacZ4823, mhpC281::Tn10, λ-, rph-1 STL14027 5 F-, lacZ4823, mhpC281::Tn10, λ-, ΔmutS738::kan, rph-1