CGSC Strain#: 6550
Strain Designation: DM1180      Source of Strain: D.W. Mount
Sex: F- Chromosomal Markers: thr-1, araC14, leuB6(Am), Δ(gpt-proA)62, tsx-33, glnX44(AS), galK2(Oc), λ^-, sulA211, Rac-0, hisG4(Oc), rfbC1, mgl-51, recA441(ts), rpsL31(strR), kdgK51, xylA5, mtl-1, lexA3(Ind-)
Strain Comments:

• leuB6(Am)-- Suppressed by serU suppressor (supH)
• glnX44(AS)-- Mutation is a C to T transition at nucleotide 34 (3rd position of the anticodon)
• galK2(Oc)-- is a GAA(glu) to TAA(ochre) mutation, residue 134. Oller et al.1993. Apparently non-suppressible, since all revertants found were at the ochre site.
• sulA211-- was formerly called sfiA11.
• sulA211-- This allele is the result of a T>C change in the -10 promoter (TACTGT -> TACTGC), which also overlaps with the LexA-binding site (TACTGTACATCCATACAGTA -> TACTGCACATCCATACAGTA)
• recA441(ts)-- formerly tif-1 (temp.-induced filamentation). Not a Rec^- phenotype, "constitutive protease activity" not requiring ss-DNA binding at hi temp.
• lexA3(Ind-)-- : Non-cleavable LexA repressor protein; defective in SOS induction, UV sensitive
• lexA3(Ind-)-- This mutation results in a G85D amino acid substitution at the lexA cleavage site.
• Δ(gpt-proA)62 was formerly called proA2
• galK2(Oc) was formerly called gal₂
• glnX44(AS) was formerly called su⁺_II
• glnX44(AS) was formerly called supE44
• glnX44(AS) was formerly called glnV44
• rfbC1 was formerly called rfbD1
• Am = amber(UAG) mutation
• AS = amber(UAG) suppressor
• Ind- = non-inducible
• Oc = ochre(UAA) mutation
• strR = streptomycin resist.
• ts = Temperature Sensitive

References:

• Mount, DW 1977. A mutant of Escherichia coli showing constitutive expression of the lysogenic induction and error-prone DNA repair pathways. Proc. Natl. Acad. Sci. U.S.A. 74(1):300-4.