CGSC Strain#: 13294
Strain Designation: SX1739     
Source of Strain: S. Xie
Sex: F-
Chromosomal Markers: Δ(argF-lac)169,
gal-490,
Δ(modF-ybhJ)803,
λ[cI857 Δ(cro-bioA)],
yhcO792-YFP(::cat),
IN(rrnD-rrnE)1,
rph-1Strain Comments: - CGSC Plate 9 Well A10
- This strain requires a Material Transfer Agreement from Harvard University prior to receiving the strain from the CGSC. Please contact Harvard University Office of Technology Development.
- Δ(argF-lac)169-- extends from mmuP through orfs preceding argF, through lac to mhpD, literally Δ(mmuP-mhpD)169. (Peters et al. 2003 JB 185:2017)
- Δ(argF-lac)169-- from strain Hfr3000 U169 was initially called ΔlacU169 and described as a lacZY mutation until found to include argF and lacI.
- gal-490-- This mutation has an IS2 insertion element in the mRNA leader of the gal operon preventing transcription.
- Δ(modF-ybhJ)803-- the deletion is about 13.7Kb and goes from the inergenic region between galE and modF to the intergenic region between ybhJ and ybhC.
- Δ(modF-ybhJ)803-- The sequence flanking the deletion is CGTAAACGCCTTATCCGGCCTACGGTTCGA Δ CGCATGCAGGCATGAAACCGCGTCTTTTTTC
- λ[cI857 Δ(cro-bioA)]-- In this prophage, the pL operon is intact and controlled by the temperature-sensitive Lambda repressor (cI857). A deletion of the right arm of the prophage from cro through the right attachment site, and extends into the bacterial bioA gene
- yhcO792-YFP(::cat)-- This allele is a protein fusion to the Venus YFP followed by the chloramphenicol resistance gene cat under its own promoter.
- IN(rrnD-rrnE)1-- Inverts the region between rrnD (73.74 min) and rrnE (90.66 min)
- rph-1-- is a 1 bp deletion that results in frameshift over last 15 codons and has polar effect on pyrE leading to suboptimal pyrimidine levels on minimal medium.(Jensen 1993 JBact.175:3401)
- Δ(modF-ybhJ)803 was formerly called
References: - Taniguchi, Y, PJ Choi, GW Li, H Chen, M Babu, J Hearn, A Emili, XS Xie 2010. Quantifying E. coli proteome and transcriptome with single-molecule sensitivity in single cells. Science 329(5991):533-8.