E. coli Genetic Resources at Yale
CGSC, The Coli Genetic Stock Center

About the CGSC

• CGSC Home
• Scope of the Collection
• The Database
• Privacy Policy
• Acknowledgment of Support

Searching the CGSC Database

• Help With Query Forms
• Strain Query
• Mutation Query
• Gene/Site Query
• Gene Product Query
• Reference Query
• Query Help
• Info on Genetic Nomenclature

How to Request Strains or Information

• Contact Information
• Charges
• Reviving Strains
• Strains Not Found?

Other CGSC Information

• FAQ on Procedures
• Current Working Map
• 1998 MMBR Map
• 1998 MMBR Gene List
• Map Diagrams (PDFs)

Other Links

• E. coli Links
• Other Stock Collections
• Other Bio Links
• Yale Web

Funded by a grant from the National Science Foundation

Mutation sulA211

• Name: sulA211
• Type: Base Pair Substitution
• Mutation of Gene: sulA
• Approx. Map Location: 21.98
• Synonyms

  Designation	Where Used
  sfiA11

  
  
• Comments
  • This allele is the result of a T>C change in the -10 promoter (TACTGT -> TACTGC), which also overlaps with the LexA-binding site (TACTGTACATCCATACAGTA -> TACTGCACATCCATACAGTA)
  • was formerly called sfiA11.
• References
• 4 Strains Carrying This Mutation

  Name	Mutations	Genotype
  DM1415	16	F-, thr-1, araC14, leuB6(Am), Δ(gpt-proA)62, tsx-33?, glnX44(AS), galK2(Oc), λ-, sulA211, recA1, rpsL31(strR), xylA5, mtl-1, thiE1?, lexA3(Ind-), lexA51
  DM1187	17	F-, thr-1, araC14, leuB6(Am), Δ(gpt-proA)62, tsx-33?, glnX44(AS), galK2(Oc), λ-, sulA211, hisG4(Oc), recA441(ts), rpsL31(strR), xylA5, mtl-1, thiE1?, lexA51, lexA3(Ind-)
  GW2707	18	F-, thr-1, araC14?, leuB6(Am), Δ(argF-lac)169, tsx-33, glnX44(AS)?, galK2(Oc), λ-, sulA211, hisG4(Oc), recA441(ts), rpsL31(strR), xylA5?, dinD1::Mud(Ap,lac)?, argE3(Oc), thiE1?, lexA71::Tn5, ilv(ts), pGW600
  DM1180	19	F-, thr-1, araC14, leuB6(Am), Δ(gpt-proA)62, tsx-33?, glnX44(AS), galK2(Oc), λ-, sulA211, Rac-0, hisG4(Oc), rfbC1, mgl-51, recA441(ts), rpsL31(strR), kdgK51, xylA5, mtl-1, lexA3(Ind-)